GENTAUR  

Papa Test      Home Up Contents

Up Modulus Microplate Modulus II Microplate Microplate Luminometer Single Tube Luminometer Modulus Single Tube TBS-380 Mini Fluorometer Picofluor Handheld Fluorometer Electrophoresis animal viruses anti-microbials API pharma ingredient Assay Lab Crystals Papa Test Brady Molecular biology

 Europe

redcoon België GENTAUR BVBA

VAT BE0473327336

Av. de l Armee 68 B4

1040 Brussels BELGIUM

  Tel + 32 16 58 90 45 

Fax + 32 16 50 90 45

GENTAUR France SARL

SIRET 48423788800017

Rue Lagrange, 9

75005 Paris, France

 Tel 01 43 25 01 50

Fax 01 43 25 01 60 

GENTAUR Germany

52074 Aachen, Germany

 +32 16 58 90 45

GENTAUR Pol Sp. Z.o.o. Ulica Ogarna 15/19B m2

80-826 GDANSK

Tel 00 48 51 760 77 08

Fax: 00 32 16 50 90 45

GENTAUR Italy

23015 Milano, Italy

 02 36 00 65 93

Česká republika Praha
+420246019719
 

Danmark

+4569918806 

Finland Helsset
+358942419041

Ελλάς Αθήνα
+302111768494
 

Ireland Dublin
+35316526556
 

Luxembourg
+35220880274
 

Magyarország Budapest
+3619980547
 

Nederland
+31208080893
 

Norge Oslo
+4721031366
 

Österreich
+43720880899
 

Sverige Stockholm
+46852503438
 

Schweiz Züri
+41435006251
 

 

Northern America 

Canada Montreal
+15149077481
 

US New York
+17185132983

 

 Asia  日本
 +81 78 386 0860

Other Countries redcoon België
0032 (0)16 41 44 07

 

Test de Paternité

Recherche d'un lien de filiation

Un Test de paternité est une pratique scientifique basée sur l'analyse de l'ADN de deux personnes faite dans le but d'établir un lien de parenté génétique et, partant de là, éventuellement juridique.

Si, en règle générale, l'identité de la mère d'un enfant ne pose pas de problèmes, celle du père peut être davantage sujette à controverses. Comment déterminer, parmi plusieurs hommes, lequel est le vrai père de l'enfant, ou comment apporter la preuve que tel homme est bien le père de l'enfant alors qu'il le nie ?

La science permet d'apporter des réponses à ces questions de filiation et, bien que dits de paternité, ces tests ADN permettent également d'établir le lien mère-enfant.

En France, cette pratique est strictement encadrée sur le plan légal.

Sommaire

Aspects scientifiques

Si différentes méthodes permettaient d'apporter un début de réponse aux questions de filiation, c'est la génétique qui permettra d'apporter des réponses les plus complètes et les plus fiables.

Méthodes simples

Des tests assez simples ne requérant aucune analyse poussée peuvent donner de premières conclusions. Cependant, ils ne permettent jamais de confirmer un lien de parenté, ils ne peuvent qu'exclure certaines hypothèses.

Rappels des principes de l'hérédité

Voici quelques rappels d'hérédité et de génétique car même les méthodes simples décrites ci-dessous trouvent leur fondement dans les gènes.

Un caractère physique (couleur de cheveux, taille, etc.) est la traduction de l'information génétique. Pour chacun de ces caractères, il existe deux informations différentes : l'une venue de la mère, l'autre venue du père. Celles-ci peuvent être contradictoires (yeux bleus vs. yeux marron) ou identiques (yeux marron et yeux marron).

Quelques règles permettent de déterminer d'après les deux copies du gène quel sera l'aspect de l'individu :

  • Si le gène s'exprime à travers des copies (allèles) codominantes, l'aspect physique correspondra à la moyenne des deux informations. Ainsi un enfant qui aura reçu un gène 'Grande taille' et un gène 'Petite taille' sera de taille moyenne.
  • Si le gène s'exprime par contre à travers des allèles dominants et récessifs, l'aspect physique correspondra au gène dominant si l'individu en possède un. Le caractère physique récessif n'apparaîtra que si la personne a reçu l'allèle récessif correspondant de son père ET de sa mère.

Lorsque cet individu aura des enfants, il transmettra soit l'allèle de son père, soit celui de sa mère.

Méthode des gènes récessifs

En étudiant les caractères exprimés par des gènes récessifs, il est possible d'écarter certaines parentés. Ainsi, si un bébé a les yeux marron mais que sa mère a les yeux bleus, il est exclu que le père de cet enfant ait également les yeux bleus.

En effet, comme l'allèle 'yeux bleus' (codant le gène 'couleur des yeux') est récessif et que l'allèle 'yeux marron' est dominant, un individu ne peut avoir les yeux bleus que si ses deux allèles du gène responsable de la couleur des yeux indiquent le bleu. Ainsi, si deux parents ont les yeux bleus, ils ne possèdent tous les deux que des allèles 'yeux bleus' du gène 'couleur des yeux' et ils ne pourront avoir que des enfants aux yeux bleus.

Cependant le caractère étant codé sur plusieurs gènes distincts, il existe des cas rares où deux parents aux yeux bleus pourront donner naissance à un enfant aux yeux d'une autre couleur.

Méthode des groupes sanguins

Les groupes sanguins donnent aussi des indications sur la filiation. Une mère de groupe 'A' ne pourra avoir d'enfant de groupe 'AB' avec un père qui est également de groupe 'A' ou qui est de groupe 'O'.

Les caractères A et B des groupes sanguins d'un enfant doivent nécessairement avoir été hérités soit du père, soit de la mère car les gènes exprimant ces 2 caractères sont codominants. Un couple de groupe sanguin A et B peut avoir un enfant de groupe O. Le gène exprimant le groupe 'O', lui, est récessif : il ne s'exprimera qu'en l'absence des autres caractères.

Si le père et la mère sont de groupe A avec, dans les deux cas, un allèle 'A' et un allèle 'O', alors ils pourront avoir des enfants :

  • de groupe 'A' avec deux allèles 'A', ou
  • de groupe 'A' avec un allèle 'A' et un allèle 'O', ou
  • de groupe 'O' avec deux allèles 'O'.

De la même manière, le rhésus négatif est récessif. Il ne s'exprimera qu'en l'absence du caractère positif. Si les parents sont de rhésus négatif, ils ne pourront pas avoir d'enfant au rhésus positif.

L'analyse ADN

Cette méthode, contrairement aux précédentes, requiert une analyse poussée de l'ADN de l'individu qui recherche ses parents ainsi que celui de son père et/ou de sa mère potentiels. Elle demande plusieurs jours mais permet d'arriver à des réponses très tranchées : soit elle écartera la filiation, soit elle conclura à une très forte probabilité de filiation (supérieure à 99%).

Principe

Chaque individu possède dans ses chromosomes des portions d'ADN qui codent des gènes et d'autres (l'ADN « poubelle ») pour lesquelles aucune utilité n'a encore été découverte. Cette dernière partie possède une caractéristique intéressante : parmi elle, certaines séquences de paires de nucléotides s'enchaînent, répétées à l'identique. Ce sont les séquences répétées nommées minisatellites. La taille de ces minisatellites, correspondant au nombre de répétitions de séquences ADN, est très variable d'un individu à l'autre et peut aller de 5 à 50.

Cette taille est une caractéristique du chromosome. Elle s'hérite donc de la même manière que les allèles de celui-ci : parmi chaque paire de chromosome d'un individu, il y en aura un qui correspondra aux caractéristiques du père et un autre à celles de la mère.

Le test de paternité consiste donc à évaluer la taille de certains minisatellites bien spécifiques. En comparant pour chaque chromosome, ces caractéristiques entre les chromosomes de l'enfant et ceux de ces parents potentiels, il est possible d'arriver à des conclusions : voir l'exemple ci-dessous.

Technique

Afin d'arriver à déterminer les tailles des minisatellites d'un individu, il faut effectuer une analyse approfondie de son ADN. Celui-ci est extrait d'un échantillon prélevé sur l'individu (sang, salive, etc.). L'ADN de chaque paire de chromosome est multiplié séparément par PCR (Réaction en chaîne par polymérase). Après cela, les brins sont découpés par une enzyme de restriction qui va isoler les minisatellites en préservant leur longueur. Ces morceaux d'ADN sont finalement analysés par électrophorèse : les molécules vont migrer et se regrouper en deux amas correspondant chacun à une taille différente de minisatellites (issus des 2 chromosomes de la paire). Comme les molécules de grande taille sont les moins mobiles, la distance parcourue permet de déterminer la taille des minisatellites.

Cette même technique est utilisée pour déterminer l'empreinte génétique d'un individu.

Exemple

Voici les cartes génétiques de 4 personnes (Aurore, Bastien, Christine et Denis) et de l'enfant de 2 d'entre eux, Émilie. Dans chaque tableau est indiqué pour chaque chromosome, la taille du minisatellite ACGCC. Ainsi Aurore possède sur son premier chromosome 14 la séquence ACGCCACGCCACGCC (nb répétition=3) et sur son autre chromosome 14, la séquence ACGCCACGCCACGCCACGCC (nb répétition=4).

ADN d'Aurore
Chromosome analysé Taille du minisatellite
chromosome 1 8 et 15
chromosome 8 13 et 14
chromosome 13 4 et 15
chromosome 14 3 et 4
ADN de Christine
Chromosome analysé Taille du minisatellite
chromosome 1 2 et 8
chromosome 8 17 et 20
chromosome 13 4 et 4
chromosome 14 2 et 14
ADN de Bastien
Chromosome analysé Taille du minisatellite
chromosome 1 8 et 18
chromosome 8 5 et 7
chromosome 13 3 et 9
chromosome 14 2 et 8
ADN de Denis
Chromosome analysé Taille du minisatellite
chromosome 1 5 et 13
chromosome 8 5 et 5
chromosome 13 4 et 18
chromosome 14 3 et 8
ADN d'Émilie
Chromosome analysé Taille du minisatellite
chromosome 1 8 et 13
chromosome 8 5 et 17
chromosome 13 4 et 4
chromosome 14 2 et 3

En comparant les différents tableaux, on arrive à la conclusion que Christine et Denis sont les parents d'Émilie. En effet, d'après le chromosome 8, Aurore ne peut être la mère de l'enfant, car elle lui aurait transmis soit 13, soit 14 répétitions, or Émilie en possède 5 et 17. De la même manière, Bastien peut être écarté en se basant sur le chromosome 13 : il aurait nécessairement transmis une de ces répétitions. Les patrimoines de Christine et Denis permettent d'expliquer complètement les caractéristiques des chromosomes d'Émilie. Afin d'augmenter encore les probabilités de filiation, il faudrait comparer ces minisatellites sur davantage de chromosomes. Les laboratoires d'analyse parviennent à assurer des tests à l'issue desquels ils peuvent annoncer une probabilité de filiation excédant les 99%.

Exemples :

  • Après de nombreux rebondissements, ces examens ont permis de montrer qu'Aurore Drossard n'était pas la fille d'Yves Montand.
  • Albert II de Monaco a reconnu son fils Alexandre Coste suite à des analyses prouvant sa paternité.
  • Le cœur de Louis XVII a été authentifié grâce à des tests qui ont comparé son génome à ceux de parentes de Marie-Antoinette.

 

Liens internes

Contact Information

Telephone
0032 1658 9045
FAX
0032 1650 9045
Postal address
Voortstraat 49, 1910 Kampenhout, BELGIUM.
Electronic mail
General Information: info@gentaur.com
Webmaster: lieven@gentaur.com

 

Home ] Up ]

Send mail to webmaster@gentaur.com with questions or comments about this web site.
Last modified: 09/28/09